Welcome
Rapid Denaturing Organic Digestion Method for Targeted Protein Identification and Characterization

Rapid Denaturing Organic Digestion Method for Targeted Protein Identification and Characterization

Bottom-up mass spectrometry-based protein evaluation strategies using protease digestion are routinely used to establish and characterize proteins with excessive specificity and sensitivity. Method efficiency is usually measured by sequence protection functionality and the entire variety of attribute peptides recognized, when in comparison with predicted databases. Limitations to generally used solvent-based digestion strategies at present employed embody lengthy digestion occasions (18-24 h or extra), resulting in protease autolysis, which additionally precludes automation, decreases sensitivity, and will increase each intra- and inter-day efficiency variability.

This report describes the event and validation of a easy, 5 min tryptic denaturing natural digestion (DOD) technique for use with tandem mass spectrometry in bottom-up protein identification and characterization. It has been evaluated throughout choose protein toxins and diagnostic scientific protein targets, considerably bettering digestion efficiency when in comparison with different solution-based and enzyme-immobilized strategies. The technique was in comparison with two at present used bottom-up strategies, the 24 h filter-aided pattern prep (FASP) and Flash Digest (1 and Four h) strategies.

Single proteins used to match the strategies included the ricin gentle chain, ricin heavy chain, ricin holotoxin, serotype A Clostridium botulinum toxin, Staphylococcus enterotoxin B, ribonuclease A, and thyroglobulin. In checks, throughout the proteins investigated, the 5 min DOD digestion technique resulted in sequence coverages starting from 55 to 100%, with comparatively excessive reproducibility and precision; outcomes have been higher than or equal to FASP technique outcomes and have been tremendously enhanced when in comparison with Flash technique outcomes.

Importantly, DOD technique intra- and inter-day precision was a lot improved as in comparison with outcomes for each FASP and Flash digestions. These knowledge indicated that the DOD technique, when in comparison with the FASP and Flash Digest strategies, dramatically diminished digestion time, whereas sustaining or bettering the flexibility to detect and characterize focused proteins, and diminished analytical variability for tryptic digestion, leading to markedly quicker and extra exact analyses.

The urinary glucose tetrasaccharide, Glcα1-6Glcα1-4Glcα1-4Glc (Glc4), is a glycogen restrict dextrin that’s elevated in sufferers with glycogen storage illness (GSD) kind III. We evaluated the potential of raw cornstarch remedy to intervene with Glc4 monitoring, by measuring the diurnal variability of Glc4 excretion in sufferers with GSD III. PLHIV reported moderate-severe ache had greater hair cortisone than these reported gentle (p=0.070) or none ache (p=0.014), with no variations between the latter two ache severity teams. Greater ache severity is related to greater hair cortisone ranges amongst Chinese PLHIV.
Voids have been collected at dwelling over 24 hours, saved at 4°C and frozen inside 48 hours. Glc4 was analyzed utilizing liquid chromatography-tandem mass spectrometry and normalized to creatinine. Subjects with GSD III (median age: 13.5 years, vary: 3.7-62; n = 18) accomplished a number of 24-hour urine assortment, and 28/36 collections have been accepted for evaluation. Glc4 was elevated in 16/18 topics (median: 13 mmol/mol creatinine, vary: 2-75, reference vary: <3). In collections with elevated Glc4 (23/28), two-thirds (15/23) had low diurnal variability in Glc4 excretion (coefficient of variation [CV%] <25). The diurnal variability was considerably correlated with the Glc4 focus (Pearson R = .644, P < .05), however not with the dose of raw cornstarch. High intraday variability (>25%) was not persistently noticed in repeat collections by the identical topic.
Rapid Denaturing Organic Digestion Method for Targeted Protein Identification and Characterization

Greater Pain Severity is Associated with Higher Glucocorticoid Levels in Hair Among a Cohort of People Living with HIV

Pain is a standard prevalence and persistent symptom, which has an antagonistic influence on particular person well-being and high quality of life amongst individuals dwelling with HIV (PLHIV). Alteration within the exercise of the Hypothalamic-Pituitary-Adrenal (HPA) axis leading to irregular glucocorticoid ranges had been proposed to play vital roles in these associations. This research aimed to analyze whether or not ache severity was related to hair glucocorticoid ranges, a novel technique of measuring long-term glucocorticoid publicity, amongst a big cohort of Chinese PLHIV.
A measure of ache severity and hair samples have been collected from 431 adults PLHIV in Guangxi, China. Glucocorticoid (cortisol and cortisone) in hair have been quantified by liquid chromatography-tandem mass spectrometry. The basic linear mannequin was used to check the associations of ache severity with hair glucocorticoid ranges after adjusting for potential confounding elements. Of the 431 PLHIV, 273 reported none ache, 87 reported gentle ache, and 71 reported moderate-severe ache. Hair cortisone, however not hair cortisol, was discovered to vary considerably among the many three ache severity teams (F=3.90, p=0.021).  In order to cut back the long-term glucocorticoid ranges, interventions managing ache must be thought of for PLHIV with moderate-severe ache.

Isotope sample deconvolution as a profitable various to calibration curve for software in wastewater-based epidemiology

An isotope sample deconvolution (IPD) quantification technique has been utilized for the willpower of 5 substances (amphetamine, benzoylecgonine, cocaine, methamphetamine and MDMA) in wastewater for the applying in wastewater-based epidemiology (WBE). A beforehand validated technique that used a calibration curve for quantification was modified to use IPD. The two approaches have been in contrast by way of analytical uncertainty in restoration research of high quality management samples, i.e. six wastewater samples from completely different geographical origins spiked at two focus ranges.

Both strategies have been dependable as they handed (z-score < 2) in an interlaboratory train. After 60 particular person determinations, IPD offered 11 outcomes exterior restoration limits (70-120%) whereas the earlier technique produced 31 antagonistic outcomes. All imply values for IPD have been correct whereas 6 out of 10 outcomes confirmed RSD values greater than 30% or recoveries exterior limits when utilizing the previous technique. Moreover, the calculated technique bias for the latter doubles that of IPD, which, in flip, makes the mixed uncertainty (u(c)) a lot greater.

ASAH2 Polyclonal Antibody

A62106 100 µg
EUR 570.55
Description: fast delivery possible

ASAH2 Rabbit pAb

A12596-100ul 100 ul
EUR 308

ASAH2 Rabbit pAb

A12596-200ul 200 ul
EUR 459

ASAH2 Rabbit pAb

A12596-20ul 20 ul
EUR 183

ASAH2 Rabbit pAb

A12596-50ul 50 ul
EUR 223

ASAH2 Rabbit pAb

A7985-100ul 100 ul
EUR 308

ASAH2 Rabbit pAb

A7985-200ul 200 ul
EUR 459

ASAH2 Rabbit pAb

A7985-20ul 20 ul
EUR 183

ASAH2 Rabbit pAb

A7985-50ul 50 ul
EUR 223

ASAH2 Antibody

24731-100ul 100ul
EUR 390

ASAH2 antibody

70R-12124 100 ug
EUR 403
Description: Rabbit polyclonal ASAH2 antibody

ASAH2 Antibody

36240-100ul 100ul
EUR 252

ASAH2 Antibody

3828-100
EUR 316

ASAH2 Antibody

3828-30T
EUR 146

ASAH2 Antibody

1-CSB-PA002170EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

ASAH2 Antibody

1-CSB-PA076840
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Antibody

1-CSB-PA133826
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Polyclonal Antibody, HRP Conjugated

A62107 100 µg
EUR 570.55
Description: reagents widely cited

ASAH2 Polyclonal Antibody, FITC Conjugated

A62108 100 µg
EUR 570.55
Description: Ask the seller for details

ASAH2 Polyclonal Antibody, Biotin Conjugated

A62109 100 µg
EUR 570.55
Description: The best epigenetics products

ASAH2 Conjugated Antibody

C36240 100ul
EUR 397

Anti-ASAH2 antibody

STJ110292 100 µl
EUR 277

Anti-ASAH2 antibody

STJ114470 100 µl
EUR 277

ASAH2 siRNA

20-abx900469
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 siRNA

20-abx908269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 siRNA

20-abx908270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 Antibody, HRP conjugated

1-CSB-PA002170EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ASAH2 Antibody, FITC conjugated

1-CSB-PA002170EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ASAH2 Antibody, Biotin conjugated

1-CSB-PA002170ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ASAH2 Blocking Peptide

33R-10941 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASAH2 antibody, catalog no. 70R-12124

ASAH2 Blocking Peptide

3828BP-50
EUR 153

ASAH2 cloning plasmid

CSB-CL865115HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2181
  • Sequence: ATGAGTGCCATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATTTAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCCGCCCAACGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGA
  • Show more
Description: A cloning plasmid for the ASAH2 gene.

Mouse ASAH2 shRNA Plasmid

20-abx974501
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ASAH2 shRNA Plasmid

20-abx987160
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ASAH2 shRNA Plasmid

20-abx961153
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASAH2 Recombinant Protein (Human)

RP036760 100 ug Ask for price

ASAH2 Recombinant Protein (Mouse)

RP117410 100 ug Ask for price

ASAH2 Recombinant Protein (Rat)

RP191108 100 ug Ask for price

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx007107
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

abx025039-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

abx025039-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx214010
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx214011
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx177710
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx173712
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody

20-abx303129
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (HRP)

20-abx303130
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (FITC)

20-abx303131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (Biotin)

20-abx303132
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Asah2 ORF Vector (Rat) (pORF)

ORF063704 1.0 ug DNA
EUR 506

ASAH2 ORF Vector (Human) (pORF)

ORF012254 1.0 ug DNA
EUR 354

Asah2 ORF Vector (Mouse) (pORF)

ORF039138 1.0 ug DNA
EUR 506

ASAH2 ELISA Kit (Human) (OKCD01831)

OKCD01831 96 Wells
EUR 831
Description: Description of target: Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid at an optimal pH of 6.5-8.5. Acts as a key regulator of sphingolipid signaling metabolites by generating sphingosine at the cell surface. Acts as a repressor of apoptosis both by reducing C16-ceramide, thereby preventing ceramide-induced apoptosis, and generating sphingosine, a precursor of the antiapoptotic factor sphingosine 1-phosphate. Probably involved in the digestion of dietary sphingolipids in intestine by acting as a key enzyme for the catabolism of dietary sphingolipids and regulating the levels of bioactive sphingolipid metabolites in the intestinal tract.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL

Asah2 sgRNA CRISPR Lentivector set (Rat)

K7087001 3 x 1.0 ug
EUR 339

ASAH2 sgRNA CRISPR Lentivector set (Human)

K0130501 3 x 1.0 ug
EUR 339

Asah2 sgRNA CRISPR Lentivector set (Mouse)

K3499601 3 x 1.0 ug
EUR 339

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) Protein

20-abx654471
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)

ELI-34287m 96 Tests
EUR 865

Human ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)

ELI-34330h 96 Tests
EUR 824

Rat ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)

ELI-48960r 96 Tests
EUR 886

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7087002 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7087003 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7087004 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0130502 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0130503 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0130504 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3499602 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3499603 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3499604 1.0 ug DNA
EUR 154

ASAH2 Protein Vector (Mouse) (pPB-C-His)

PV156550 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPB-N-His)

PV156551 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPM-C-HA)

PV156552 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPM-C-His)

PV156553 500 ng
EUR 1065

ASAH2 Protein Vector (Rat) (pPB-C-His)

PV254814 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPB-N-His)

PV254815 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPM-C-HA)

PV254816 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPM-C-His)

PV254817 500 ng
EUR 1166

ASAH2 Protein Vector (Human) (pPB-His-MBP)

PV324138 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPB-His-GST)

PV324139 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPB-C-His)

PV049013 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPB-N-His)

PV049014 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPM-C-HA)

PV049015 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPM-C-His)

PV049016 500 ng
EUR 329

Asah2 3'UTR GFP Stable Cell Line

TU152183 1.0 ml Ask for price

Asah2 3'UTR Luciferase Stable Cell Line

TU102183 1.0 ml Ask for price

Asah2 3'UTR Luciferase Stable Cell Line

TU200951 1.0 ml Ask for price

Asah2 3'UTR GFP Stable Cell Line

TU250951 1.0 ml Ask for price

ASAH2 3'UTR GFP Stable Cell Line

TU051220 1.0 ml
EUR 1521

ASAH2 3'UTR Luciferase Stable Cell Line

TU001220 1.0 ml
EUR 1521

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

20-abx156834
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) CLIA Kit

20-abx494694
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ASAH2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV656977 1.0 ug DNA
EUR 1355

ASAH2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV656981 1.0 ug DNA
EUR 1355

ASAH2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV656982 1.0 ug DNA
EUR 1355

Human N-Acylsphingosine Amidohydrolase 2(ASAH2)ELISA Kit

QY-E04735 96T
EUR 361

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

SEE689Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

SEE689Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

SEE689Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

SEE689Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit

4-SEE689Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as N-Acylsphingosine Amidohydrolase 2 elisa. Alternative names of the recognized antigen: HNAC1
  • non-lysosomal ceramidase
  • Neutral ceramidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

Consequently, a easy change of information treatment-IPD quantification methodology-resulted in a decrease uncertainty of the estimated illicit drug focus, one of many principal steps contributing to the ultimate uncertainty within the normalized each day drug consumption by means of WBE. The present research demonstrated that the employment of IPD may also be very attention-grabbing for future purposes of WBE, particularly when matrix results are excessive, complicating correct quantification. In addition, when a excessive variety of samples and/or compounds have to be analysed, IPD is quicker than calibration and, finally, cost-effective when isotopically labelled inner customary is very costly.