Welcome
Rapid Denaturing Organic Digestion Method for Targeted Protein Identification and Characterization
Antibodies / Assay Kits / Biology Cells / cDNA / Clia Kits / Diagnostic Accuracy of MALDI-TOF Mass Spectrometry for the Direct Identification of Clinical Pathogens from Urine. / Exosomes / Gels / General / Isotypes / Medium & Serums / NATtrol / Pharmacokinetic Studies of Antisense Oligonucleotides Using MALDI-TOF Mass Spectrometry. / Proteins / Reagents Recombinant / Ria Kits / RNA / Test Kits / Vector & Virus

Rapid Denaturing Organic Digestion Method for Targeted Protein Identification and Characterization

- March 18, 2021 | March 19, 2021 - Barry Alexander

Bottom-up mass spectrometry-based protein evaluation strategies using protease digestion are routinely used to establish and characterize proteins with excessive specificity and sensitivity. Method efficiency is usually measured by sequence protection functionality and the entire variety of attribute peptides recognized, when in comparison with predicted databases. Limitations to generally used solvent-based digestion strategies at present employed embody lengthy digestion occasions (18-24 h or extra), resulting in protease autolysis, which additionally precludes automation, decreases sensitivity, and will increase each intra- and inter-day efficiency variability.

This report describes the event and validation of a easy, 5 min tryptic denaturing natural digestion (DOD) technique for use with tandem mass spectrometry in bottom-up protein identification and characterization. It has been evaluated throughout choose protein toxins and diagnostic scientific protein targets, considerably bettering digestion efficiency when in comparison with different solution-based and enzyme-immobilized strategies. The technique was in comparison with two at present used bottom-up strategies, the 24 h filter-aided pattern prep (FASP) and Flash Digest (1 and Four h) strategies.

Single proteins used to match the strategies included the ricin gentle chain, ricin heavy chain, ricin holotoxin, serotype A Clostridium botulinum toxin, Staphylococcus enterotoxin B, ribonuclease A, and thyroglobulin. In checks, throughout the proteins investigated, the 5 min DOD digestion technique resulted in sequence coverages starting from 55 to 100%, with comparatively excessive reproducibility and precision; outcomes have been higher than or equal to FASP technique outcomes and have been tremendously enhanced when in comparison with Flash technique outcomes.

Importantly, DOD technique intra- and inter-day precision was a lot improved as in comparison with outcomes for each FASP and Flash digestions. These knowledge indicated that the DOD technique, when in comparison with the FASP and Flash Digest strategies, dramatically diminished digestion time, whereas sustaining or bettering the flexibility to detect and characterize focused proteins, and diminished analytical variability for tryptic digestion, leading to markedly quicker and extra exact analyses.

The urinary glucose tetrasaccharide, Glcα1-6Glcα1-4Glcα1-4Glc (Glc4), is a glycogen restrict dextrin that’s elevated in sufferers with glycogen storage illness (GSD) kind III. We evaluated the potential of raw cornstarch remedy to intervene with Glc4 monitoring, by measuring the diurnal variability of Glc4 excretion in sufferers with GSD III. PLHIV reported moderate-severe ache had greater hair cortisone than these reported gentle (p=0.070) or none ache (p=0.014), with no variations between the latter two ache severity teams. Greater ache severity is related to greater hair cortisone ranges amongst Chinese PLHIV.
Voids have been collected at dwelling over 24 hours, saved at 4°C and frozen inside 48 hours. Glc4 was analyzed utilizing liquid chromatography-tandem mass spectrometry and normalized to creatinine. Subjects with GSD III (median age: 13.5 years, vary: 3.7-62; n = 18) accomplished a number of 24-hour urine assortment, and 28/36 collections have been accepted for evaluation. Glc4 was elevated in 16/18 topics (median: 13 mmol/mol creatinine, vary: 2-75, reference vary: <3). In collections with elevated Glc4 (23/28), two-thirds (15/23) had low diurnal variability in Glc4 excretion (coefficient of variation [CV%] <25). The diurnal variability was considerably correlated with the Glc4 focus (Pearson R = .644, P < .05), however not with the dose of raw cornstarch. High intraday variability (>25%) was not persistently noticed in repeat collections by the identical topic.
Rapid Denaturing Organic Digestion Method for Targeted Protein Identification and Characterization

Greater Pain Severity is Associated with Higher Glucocorticoid Levels in Hair Among a Cohort of People Living with HIV

Pain is a standard prevalence and persistent symptom, which has an antagonistic influence on particular person well-being and high quality of life amongst individuals dwelling with HIV (PLHIV). Alteration within the exercise of the Hypothalamic-Pituitary-Adrenal (HPA) axis leading to irregular glucocorticoid ranges had been proposed to play vital roles in these associations. This research aimed to analyze whether or not ache severity was related to hair glucocorticoid ranges, a novel technique of measuring long-term glucocorticoid publicity, amongst a big cohort of Chinese PLHIV.
A measure of ache severity and hair samples have been collected from 431 adults PLHIV in Guangxi, China. Glucocorticoid (cortisol and cortisone) in hair have been quantified by liquid chromatography-tandem mass spectrometry. The basic linear mannequin was used to check the associations of ache severity with hair glucocorticoid ranges after adjusting for potential confounding elements. Of the 431 PLHIV, 273 reported none ache, 87 reported gentle ache, and 71 reported moderate-severe ache. Hair cortisone, however not hair cortisol, was discovered to vary considerably among the many three ache severity teams (F=3.90, p=0.021).  In order to cut back the long-term glucocorticoid ranges, interventions managing ache must be thought of for PLHIV with moderate-severe ache.

Isotope sample deconvolution as a profitable various to calibration curve for software in wastewater-based epidemiology

An isotope sample deconvolution (IPD) quantification technique has been utilized for the willpower of 5 substances (amphetamine, benzoylecgonine, cocaine, methamphetamine and MDMA) in wastewater for the applying in wastewater-based epidemiology (WBE). A beforehand validated technique that used a calibration curve for quantification was modified to use IPD. The two approaches have been in contrast by way of analytical uncertainty in restoration research of high quality management samples, i.e. six wastewater samples from completely different geographical origins spiked at two focus ranges.

Both strategies have been dependable as they handed (z-score < 2) in an interlaboratory train. After 60 particular person determinations, IPD offered 11 outcomes exterior restoration limits (70-120%) whereas the earlier technique produced 31 antagonistic outcomes. All imply values for IPD have been correct whereas 6 out of 10 outcomes confirmed RSD values greater than 30% or recoveries exterior limits when utilizing the previous technique. Moreover, the calculated technique bias for the latter doubles that of IPD, which, in flip, makes the mixed uncertainty (u(c)) a lot greater.

ASAH2 Polyclonal Antibody
A62106 100 µg
EUR 570.55
Description: fast delivery possible

ASAH2 Rabbit pAb
A12596-100ul 100 ul
EUR 308

ASAH2 Rabbit pAb
A12596-200ul 200 ul
EUR 459

ASAH2 Rabbit pAb
A12596-20ul 20 ul
EUR 183

ASAH2 Rabbit pAb
A12596-50ul 50 ul
EUR 223

ASAH2 Rabbit pAb
A7985-100ul 100 ul
EUR 308

ASAH2 Rabbit pAb
A7985-200ul 200 ul
EUR 459

ASAH2 Rabbit pAb
A7985-20ul 20 ul
EUR 183

ASAH2 Rabbit pAb
A7985-50ul 50 ul
EUR 223

ASAH2 Antibody
36240-100ul 100ul
EUR 252

ASAH2 Antibody
3828-100
EUR 316

ASAH2 Antibody
3828-30T
EUR 146

ASAH2 Antibody
24731-100ul 100ul
EUR 390

ASAH2 antibody
70R-12124 100 ug
EUR 403
Description: Rabbit polyclonal ASAH2 antibody

ASAH2 Antibody
1-CSB-PA002170EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

ASAH2 Antibody
1-CSB-PA133826
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Antibody
1-CSB-PA076840
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Polyclonal Antibody, HRP Conjugated
A62107 100 µg
EUR 570.55
Description: reagents widely cited

ASAH2 Polyclonal Antibody, FITC Conjugated
A62108 100 µg
EUR 570.55
Description: Ask the seller for details

ASAH2 Polyclonal Antibody, Biotin Conjugated
A62109 100 µg
EUR 570.55
Description: The best epigenetics products

ASAH2 Conjugated Antibody
C36240 100ul
EUR 397

Anti-ASAH2 antibody
STJ110292 100 µl
EUR 277

Anti-ASAH2 antibody
STJ114470 100 µl
EUR 277

ASAH2 siRNA
20-abx900469
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 siRNA
20-abx908269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 siRNA
20-abx908270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 Antibody, HRP conjugated
1-CSB-PA002170EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ASAH2 Antibody, FITC conjugated
1-CSB-PA002170EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ASAH2 Antibody, Biotin conjugated
1-CSB-PA002170ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ASAH2 Blocking Peptide
33R-10941 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASAH2 antibody, catalog no. 70R-12124

ASAH2 Blocking Peptide
3828BP-50
EUR 153

ASAH2 cloning plasmid
CSB-CL865115HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2181
  • Sequence: ATGAGTGCCATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATTTAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCCGCCCAACGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGA
  • Show more
Description: A cloning plasmid for the ASAH2 gene.

Mouse ASAH2 shRNA Plasmid
20-abx974501
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ASAH2 shRNA Plasmid
20-abx987160
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ASAH2 shRNA Plasmid
20-abx961153
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASAH2 Recombinant Protein (Human)
RP036760 100 ug Ask for price

ASAH2 Recombinant Protein (Rat)
RP191108 100 ug Ask for price

ASAH2 Recombinant Protein (Mouse)
RP117410 100 ug Ask for price

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx007107
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
abx025039-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
abx025039-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx173712
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx177710
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx214010
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx214011
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx303129
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (HRP)
20-abx303130
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (FITC)
20-abx303131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (Biotin)
20-abx303132
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Asah2 ORF Vector (Mouse) (pORF)
ORF039138 1.0 ug DNA
EUR 506

ASAH2 ORF Vector (Human) (pORF)
ORF012254 1.0 ug DNA
EUR 354

Asah2 ORF Vector (Rat) (pORF)
ORF063704 1.0 ug DNA
EUR 506

ASAH2 ELISA Kit (Human) (OKCD01831)
OKCD01831 96 Wells
EUR 831
Description: Description of target: Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid at an optimal pH of 6.5-8.5. Acts as a key regulator of sphingolipid signaling metabolites by generating sphingosine at the cell surface. Acts as a repressor of apoptosis both by reducing C16-ceramide, thereby preventing ceramide-induced apoptosis, and generating sphingosine, a precursor of the antiapoptotic factor sphingosine 1-phosphate. Probably involved in the digestion of dietary sphingolipids in intestine by acting as a key enzyme for the catabolism of dietary sphingolipids and regulating the levels of bioactive sphingolipid metabolites in the intestinal tract.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL

ASAH2 sgRNA CRISPR Lentivector set (Human)
K0130501 3 x 1.0 ug
EUR 339

Asah2 sgRNA CRISPR Lentivector set (Mouse)
K3499601 3 x 1.0 ug
EUR 339

Asah2 sgRNA CRISPR Lentivector set (Rat)
K7087001 3 x 1.0 ug
EUR 339

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) Protein
20-abx654471
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0130502 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0130503 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0130504 1.0 ug DNA
EUR 154

Mouse ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-34287m 96 Tests
EUR 865

Human ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-34330h 96 Tests
EUR 824

Rat ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-48960r 96 Tests
EUR 886

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3499602 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3499603 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3499604 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7087002 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7087003 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7087004 1.0 ug DNA
EUR 154

ASAH2 Protein Vector (Human) (pPB-C-His)
PV049013 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPB-N-His)
PV049014 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPM-C-HA)
PV049015 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPM-C-His)
PV049016 500 ng
EUR 329

ASAH2 Protein Vector (Human) (pPB-His-MBP)
PV324138 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPB-His-GST)
PV324139 500 ng
EUR 481

ASAH2 Protein Vector (Rat) (pPB-C-His)
PV254814 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPB-N-His)
PV254815 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPM-C-HA)
PV254816 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPM-C-His)
PV254817 500 ng
EUR 1166

ASAH2 Protein Vector (Mouse) (pPB-C-His)
PV156550 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPB-N-His)
PV156551 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPM-C-HA)
PV156552 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPM-C-His)
PV156553 500 ng
EUR 1065

Asah2 3'UTR Luciferase Stable Cell Line
TU200951 1.0 ml Ask for price

Asah2 3'UTR GFP Stable Cell Line
TU152183 1.0 ml Ask for price

ASAH2 3'UTR Luciferase Stable Cell Line
TU001220 1.0 ml
EUR 1521

Asah2 3'UTR Luciferase Stable Cell Line
TU102183 1.0 ml Ask for price

ASAH2 3'UTR GFP Stable Cell Line
TU051220 1.0 ml
EUR 1521

Asah2 3'UTR GFP Stable Cell Line
TU250951 1.0 ml Ask for price

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
20-abx156834
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) CLIA Kit
20-abx494694
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ASAH2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV656977 1.0 ug DNA
EUR 1355

ASAH2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV656981 1.0 ug DNA
EUR 1355

ASAH2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV656982 1.0 ug DNA
EUR 1355

Human N-Acylsphingosine Amidohydrolase 2(ASAH2)ELISA Kit
QY-E04735 96T
EUR 361

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
4-SEE689Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as N-Acylsphingosine Amidohydrolase 2 elisa. Alternative names of the recognized antigen: HNAC1
  • non-lysosomal ceramidase
  • Neutral ceramidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Consequently, a easy change of information treatment-IPD quantification methodology-resulted in a decrease uncertainty of the estimated illicit drug focus, one of many principal steps contributing to the ultimate uncertainty within the normalized each day drug consumption by means of WBE. The present research demonstrated that the employment of IPD may also be very attention-grabbing for future purposes of WBE, particularly when matrix results are excessive, complicating correct quantification. In addition, when a excessive variety of samples and/or compounds have to be analysed, IPD is quicker than calibration and, finally, cost-effective when isotopically labelled inner customary is very costly.